kl800.com省心范文网

Mycoepoxydiene suppresses RANKL-induced osteoclast


Appl Microbiol Biotechnol DOI 10.1007/s00253-012-4146-5

APPLIED MICROBIAL AND CELL PHYSIOLOGY

Mycoepoxydiene suppresses RANKL-induced osteoclast differentiation and reduces ovariectomy-induced bone loss in mice
Jingwei Zhu & Qiang Chen & Xiaochun Xia & Pingli Mo & Yuemao Shen & Chundong Yu

Received: 20 March 2012 / Revised: 23 April 2012 / Accepted: 25 April 2012 # Springer-Verlag 2012

Abstract Mycoepoxydiene (MED) is a compound isolated from the marine fungal Diaporthe sp. HLY-1 associated with mangroves. MED has various biological effects such as antimicrobial, anti-cancer, and anti-inflammatory activities. However, the effect of MED on the differentiation of osteoclasts, the multinucleated bone-resorbing cells which play a crucial role in bone remodeling, is still unknown. In this study, we showed that MED could inhibit receptor activator of NF-κB ligand (RANKL)-induced osteoclast differentiation and the expression of three well-known osteoclast markers such as tartrateresistant acid phosphatase, calcitonin receptor, and cathepsin K in bone marrow-derived macrophages. Furthermore, we found that MED inhibited the expression of nuclear factor of activated T cells c1, a key transcriptional factor in osteoclast differentiation, via inhibiting the phosphorylation of TAK1 and then blocking the activation of NF-κB and ERK1/2 pathways. Moreover, MED could prevent bone loss in ovariectomized mice. Taken together, we demonstrate for the first time that MED can suppress RANKL-induced osteoclast differentiation in vitro and ovariectomy-induced osteoporosis in vivo, suggesting that MED is a potential lead compound for the development of novel drugs for osteoporosis treatment. Keywords Mycoepoxydiene . Osteoclast differentiation . NF-кB . ERK1/2 . NFATc1
J. Zhu : Q. Chen : X. Xia : P. Mo : C. Yu (*) State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, China e-mail: cdyu@xmu.edu.cn Y. Shen (*) School of Pharmaceutical Sciences, Shandong University, Jinan, China e-mail: yshen@sdu.edu.cn

Introduction Bone remodeling is a continuous event throughout life. It is composed of osteoblastic bone formation and osteoclastic bone resorption (Mellis et al. 2011). An imbalance between these two events leads to metabolic bone diseases such as osteopetrosis and osteoporosis. Osteoporosis, on account of excessive bone resorption, is mainly induced by abnormal differentiation of osteoclast. Therefore, inhibiting the function and differentiation of osteoclast becomes one of the main strategies for treatment of osteoporosis (Teitelbaum 2000). Osteoclasts, the multinucleated giant cells with tartrateresistant acid phosphatase (TRAP) positive staining character, play an important role in calcium homeostasis (Boyle et al. 2003). They are terminal differentiated cells derived from hematopoietic stem cell lineage. Differentiation of osteoclast is precisely regulated by macrophage colony stimulating factor (M-CSF) and receptor activator of NF-κB ligand (RANKL) (Wiktor-Jedrzejczak et al. 1990). These regulators are mainly produced by osteoblasts and stromal cells (Omata and Tanaka 2011). M-CSF is involved in the generation of progenitors for macrophages and osteoclast. It is an essential factor to sustain macrophage survival and proliferation (Asagiri and Takayanagi 2007). It also up-regulates RANK expression in osteoclast precursor cells (Arai et al. 1999; Asagiri and Takayanagi 2007). RANKL, which belongs to tumor necrosis factor (TNF) superfamily, can bind to its receptor RANK located on osteoclast precursor cell membrane (Kong et al. 1999; Nakashima et al. 2011). Subsequently, they recruit adaptor molecules such as TNF-α receptor associated factor 6 (TRAF6) (Kobayashi et al. 2001; Darnay et al. 1999), which forms a complex with RANK and TAB [TGF-β-activated kinase (TAK) binding protein] 2 and leads to TAK1 activation. TAK1 activation further results in the activation of

Appl Microbiol Biotechnol

NF-κB and MAPKs, which induces the expression of nuclear factor of activated T cells c1 (NFATc1). NFATc1 belongs to the NFAT transcription superfamily, which is a key transcriptional factor in osteoclast differentiation (Ishida et al. 2002; Takayanagi et al. 2002; Hirotani et al. 2004). NFATc1 and its cooperators can bind to the promoter of osteoclast-associated genes such as TRAP, calcitonin receptor (CTR), and cathepsin K and regulate their expression (Asagiri and Takayanagi 2007; Jiang et al. 2006). Mycoepoxydiene (MED) is a fungal polyketide isolated from a marine fungal Diaporthe sp. (D. sp.) HLY-1 associated with mangrove forests (Lin et al. 2005). It contains an α,β-unsaturated δ-lactone moiety and an oxygen-bridged cyclooctadiene core (Takao et al. 2002). It has been shown to induce cell cycle arrest and apoptosis in HeLa cells (Wang et al. 2010). Recently, we found that MED inhibited LPS-induced inflammatory responses (unpublished results). Since numerous studies have suggested that osteoclastogenesis is related to inflammatory responses (Baron 2004; Takayanagi 2005), we hypothesize that MED might also inhibit osteoclast differentiation. In this study, we showed that MED suppressed RANKL-induced differentiation of osteoclast by inhibiting the expression of NFATc1 via inhibiting the phosphorylation of TAK1 and then blocking the activation of NF-κB and ERK1/2 pathways. Furthermore, MED prevented ovariectomy-induced osteoporosis in mice.

Cytotoxicity assay The cytotoxicity of MED was analyzed by MTT assay. A total of 7×103 cells/well was seeded into a 96-well plate. After incubation of MED for 72 h, 10 μl of MTT (5 mg/ml, Sigma) was added to each well. The plates were incubated for 4 h before addition of 100 μl of lysis buffer (10 % SDS in 0.01 M HCl). The absorbance was measured at 560 nm using a microplate reader. Isolation of bone marrow cells and formation of bone marrow-derived macrophages Primary bone marrow cells were isolated from femur and tibiae of 4-week-old C57BL/6 mice. After flushing the marrow with 10 ml of alpha-10 MEM (containing 10 % FBS) using a 23 g needle, all bone marrow cells were collected and incubated at 37 °C and 7 % CO2 overnight. The next day, all non-adherent cells were collected and centrifuged at 500g for 5 min, and then the cells were resuspended and cultured in alpha-10 MEM supplemented with 10 %M-CSF. After being stimulated by M-CSF to 100 % confluence, bone marrowderived macrophages (BMMs) were seeded into a 48-well plate at a density of 2×104 cells/well for osteoclast formation using a differentiation medium (Chen et al. 2010). Osteoclast formation and TRAP activity positive staining For osteoclast formation, BMMs were induced by RANKL (50 ng/ml) for 4 days. Then, cells were fixed and stained for TRAP activity using TRAP staining kit according to the manufacturer’s instructions. Multinucleated cells with red cytoplasm were counted as osteoclasts. Quantitative real-time PCR Total RNA was isolated from cells with Trizol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription was performed using MMLV transcriptase (ToYoBo, Shanghai, China) with random primers. Real-time PCRs were performed using SYBR Premix ExTaq (TaKaRa, Dalian, China). Quantification was normalized to the amount of endogenous GAPDH. The primers used for real-time PCR were listed in Table 1. Western blot analysis Cells were lysed with lysis buffer (200 mM Tris–HCl (pH 7.5), 1.5 M NaCl, 10 mM EDTA, 25 mM sodium pyrophosphate, 10 mM glycerolphosphate, 10 mM sodium orythovanadate, 50 mM NaF, 1 mM PMSF, in combination with protein inhibitor cocktail). Twenty micrograms of protein lysates of each sample was subjected to SDS-PAGE and

Materials and methods Materials The marine fungal D. sp. HLY-1 is derived from the marine lignicolous fungal strain HLY2, which is stored in the China Center for Type Culture Collection (Wuhan) under CCTCC No. 204061. MED was isolated from the fermentation broth of D. sp. HLY-1 as described (Lin et al. 2005). The identity of MED was confirmed by HRMS and 1 H and 13 C NMR analysis and the purity of MED exceeded 95.7 % according to the HPLC analysis. MED was dissolved in dimethyl sulfoxide (DMSO). Alpha-10 MEM, TRAP staining kit, and β-actin antibody were obtained from Sigma Aldrich (Sigma, St Louis, MO, USA); recombinant mouse RANKL was purchased from R&D Systems (Minneapolis, MN, USA); fetal bovine serum (FBS) was obtained from Gibco (Gibco, Grand Island, NY, USA); anti-NFATc1, anti-IкBα, and anti-GAPDH antibodies were purchased from Santa Cruz (Santa Cruz, CA, USA); antibodies against phospho-ERK1/2, ERK1/2, phospho-TAK1, TAK1 were purchased from Cell Signaling Technology (Danvers, MA, USA).

Appl Microbiol Biotechnol Table 1 Primers for real-time PCR

Gene TRAP Cathepsin K Calcitonin receptor GAPDH

Sense GCTGGAAACCATGATCACCT CTTCCAATACGTGCAGCAGA TGCAGACAACTCTTGGTTGG GACCACAGTCCATGCCATCAC

Antisense GAGTTGCCACACAGCATCAC TCTTCAGGGCTTTCTCGTTC TCGGTTTCTTCTCCTCTGGA CATACCAGGAAATGAGCTTGAC

transferred onto nitrocellulose membranes. Blots were incubated with the specific primary antibodies overnight at 4 °C. After being washed three times for 15 min each with TBST (TBS+0.1 % Tween20), blots were incubated with horseradish peroxidase-conjugated secondary antibody (Pierce, Rockford, IL, USA) and visualized by chemiluminescence. Ovariectomy-induced osteoporosis Six-week-old C57BL/6 mice were purchased from Shanghai SLAC Laboratory Animal Co. Ltd (Shanghai, China). Mice were housed under a 12-h light/dark cycle in the specific pathogen-free facility. Mice were divided into four groups at random. Ovariectomy was carried out in experimental group mice. After 2 weeks, DMSO, 4 mg/kg/day MED, and 8 mg/ kg/day MED were intraperitoneally injected into mice every 2 days for 2 months, respectively. At the end of experiments, all mice were sacrificed and both femur and tibia were isolated for bone mineral density analysis and MicroCT analysis. Animal experiments were performed in accordance with the Laboratory Animal Center of Xiamen University. All animal experimental procedures were approved by the Animal Care and Use Committee of Xiamen University (Protocol Number: XMULAC20120001). Every effort was made to reduce the suffering of animals. Statistical analysis All experiments were repeated for at least three times, each time with triplicates. Two-tailed Student’st-test in SPSS 11.0 was used in data analysis. All data were expressed as means±SD (*p<0.05, **p<0.01). Bars in the graph represent standard deviation.

this difference did not reach significance (p>0.05). These results indicate that MED has no cytotoxicity to BMMs in the concentration range between 0.5 and 10 μM. Therefore, MED in a concentration range of 0.5 to 5 μM was used in subsequent in vitro experiments. MED significantly suppresses osteoclast formation To investigate whether MED has an effect on osteoclast formation induced by RANKL, the number of TRAPpositive multinucleated cells was measured after stimulation of RANKL in BMMs. As shown in Fig. 2a, MED suppressed osteoclast formation in a dose-dependent manner. Osteoclastogenesis is a very sophisticated process including cell proliferation, differentiation, fusion, activation, and survival (Huber et al. 2001; Remen et al. 2011; Miyamoto and Suda 2003). Therefore, to further determine which stage of osteoclast formation is blocked by MED, 5 μM MED was added when BMMs had been stimulated by RANKL for 0, 24, 48, and 72 h, respectively. The results showed that MED inhibited osteoclast formation only when MED treatment was simultaneous with RANKL stimulation (0 h), indicating that MED suppresses osteoclast formation at the very early differentiation stage (Fig. 2b). Furthermore, we examined whether MED inhibits the expression of osteoclast-associated genes such as TRAP, CTR, and cathepsin K in the presence of RANKL by quantitative real-time PCR. Results showed that the mRNA
MTT assay Relative absorption at 560 nm 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 0 0.5 1 MED (μ M) 5 10

Results MED has no cytotoxicity to BMMs MED is a novel polyketide containing an oxygen-bridged cyclooctadiene core and an α,β-unsaturated δ-lactone moiety. Before examining the effect of MED on osteoclast differentiation, we detected the cytotoxicity of MED to BMMs using MTT assay. As shown in Fig. 1, there was a slight increase in relative absorption with MED dosing, but

Fig. 1 Effect of MED on the viability of bone marrow-derived macrophages. BMMs were seeded into a 96-well plate at 7×103 cells/well. After adhesion, cells were treated with MED at indicated doses for 72 h. Cell viability was evaluated by MTT assay

Appl Microbiol Biotechnol Fig. 2 Effect of MED on the RANKL-induced osteoclast differentiation. a Inhibition of osteoclast differentiation by MED in a dose-dependent manner. BMMs were plated on a 48-well plate at 2×104 cells/well and cultured in the presence of RANKL (50 ng/ml) for 4 days. Following TRAP staining, cells with more than three nuclei were counted. Compared with RANKL group, MED treatment markedly inhibited the differentiation of osteoclast in a concentrationdependent manner. The relative number of TRAP stainingpositive cells is expressed as means±SD. b MED inhibits osteoclast differentiation at the early stage. BMMs were seeded into a 48-well plate at 2×104 cells/well and cultured in the presence of RANKL (50 ng/ml) for 4 days. MED was added into the medium after RANKL stimulating for 0, 24, 48, and 72 h, respectively. TRAPpositive cells with more than three nuclei were counted. The relative osteoclast number is expressed as mean±SD. *p<0.05, **p<0.01

a

Control

RANKL

R+MED (1 μM) R+MED (2.5 μM) R+MED (5 μM)

Relative Osteoclast number

1.2 1.0 0.8 0.6 0.4 0.2 0 + 24 h + 1 + 2.5 48 h + 5 μM 72 h

* **

RANKL

MED

b

0h

**
Relative Osteoclast number 1.2 1.0 0.8 0.6 0.4 0.2 0 RANKL + MED -

+ 0h

+ 24 h

+ 48 h

+ 72 h

levels of TRAP, CTR, and cathepsin K were dramatically induced after RANKL stimulation, whereas MED significantly inhibited RANKL-induced expression of these genes at a concentration of 5 μM (Fig. 3a–c), suggesting that MED suppresses osteoclast formation at least in part through inhibiting the expression of RANKL-induced osteoclast-associated genes including TRAP, CTR, and cathepsin K.

MED suppresses RANKL-induced activation of NF-кB and ERK1/2 via blocking TAK1 activation RANKL-induced NF-κB activation plays an essential role in osteoclast differentiation and formation (Franzoso et al. 1997). The hallmark of RANKL-induced activation of NF-κB signaling pathway is the fast degradation of IκBα to allow

Appl Microbiol Biotechnol

a
TRAP (Relative expression)

300 250 200 150 100 50 0 Control RANKL

a

RANKL 0 – MED

2 –

5 15 30 60 0 – – – – +

2 5 15 30 60 min + + + + + -IκB α -pERK1/2 -ERK1/2

*
Relative Expression
R+MED

-GAPDH 1.2 1.0 0.8 0.6 0.4 0.2 0 10 8 6 4 2 0 0 2 5 15 30 60 min 0 2 5 15 30 60 min Ctrl MED Iκ B α /GAPDH Ctrl MED

b
(Relative expression) Cathepsin K

1400 1200 1000 800 600 400 200 0 Control RANKL R+MED

**

c
CTR (Relative expression)

60000 50000 40000 30000 20000 10000

b

RANKL 0 MED –

Relative Expression

pERK/ERK

2 –

5 15 30 60 0 – – – – +

2 5 15 30 60 min + + + + + -pTAK1

**
0 Control RANKL R+MED

-TAK1 -β-actin

NF-κB translocation from the cytoplasm to the nucleus to induce target gene expression. To determine whether MED can inhibit RANKL-induced NF-κB activation, we examined the effect of MED on the degradation of IκBα after RANKL stimulation. The results showed that MED inhibited the degradation of IκBα induced by RANKL in BMMs, indicating that MED can suppress RANKLinduced NF-κB activation (Fig. 4a). In addition to NF-кB, MAPKs such as ERK1/2 are involved in osteoclastogenesis (Yamashita et al. 2010; Takami et al. 2005; He et al. 2011a). Therefore, the effect of MED on the activation of ERK1/2 was examined by detecting the phosphorylation of these kinases. As shown in Fig. 4a, MED significantly suppressed RANKL-induced phosphorylation of ERK1/2, indicating that MED can suppress RANKL-induced activation of ERK1/2. To determine whether the activation of TAK1, an upstream activator of NF-κB and ERK1/2, is affected by MED, we

Relative Expression

Fig. 3 Expression of osteoclast marker genes. BMMs were stimulated with or without 5 μM MED in the presence of RANKL and M-CSF for 72h. The mRNA level of three marker genes including TRAP (a), CTR (b), and cathepsin K (c) were detected by real-time PCR. Results are expressed as means±SD of three independent experiments. *p<0.05, **p<0.01

14 12 10 8 6 4 2 0 0 2

pTAK1/TAK1 Ctrl MED

5

15

30

60 min

Fig. 4 Effect of MED on RANKL-induced cell signaling pathways. a Effect of MED on RANKL-induced IκBα degradation and ERK phosphorylation. BMMs were stimulated by 50 ng/ml RANKL without or with 5 μM MED for the indicated times. IκBα expression was expressed as fold change compared with non-stimulated cells (fold value is 1) and normalized against GAPDH. p-ERK protein expression was expressed as fold change compared with non-stimulated cells (fold value is 1) and normalized against total ERK. b Effect of MED on RANKL-induced TAK1 phosphorylation. BMMs were stimulated by 50 ng/ml RANKL without or with 5 μM MED for the indicated times. p-TAK1 protein expression was expressed as fold change compared with non-stimulated cells (fold value is 1) and normalized against total TAK1

detected the phosphorylation of TAK1 induced by RANKL. Results showed that MED inhibited the RANKL-induced phosphorylation of TAK1 in BMMs, indicating that MED

Appl Microbiol Biotechnol
RANKL – MED – 16 – 60 – 96 – – + 16 + 60 + 96 h + -NFATc1 -GAPDH NFATc1/GAPDH

may suppress RANKL-induced NF-κB and ERK1/2 activation through inhibiting TAK1 activation (Fig. 4b). MED suppresses RANKL-induced NFATc1 expression NFATc1 is a key transcriptional factor in osteoclast differentiation and regulates the expression of TRAP, CTR, and cathepsin K. Therefore, we examined the expression of NFATc1 induced by RANKL. As shown in Fig. 5, NFATc1 protein expression was stimulated by RANKL, but its expression was repressed by MED at 16 h after RANKL stimulation. Interestingly, MED treatment did not affect NFATc1 induction at 60 and 96 h after RANKL stimulation. These results suggest that MED inhibits NFATc1 induction at the early stage of osteoclastogenesis and this inhibition can further suppress the expression of osteoclast-associated genes as well as the whole process of osteoclastogenesis. MED protects mice from ovariectomy-induced bone loss Ovariectomy-induced bone loss in mice is a well-established osteoporosis disease model which mimics osteoporosis in

Relative Expression

2.5 2.0 1.5 1.0 0.5 0 0

Ctrl MED

16

60

96 h

Fig. 5 Effect of MED on RANKL-induced NFATc1 expression. BMMs were stimulated with 50 ng/ml RANKL for 16, 60, and 96 h in the absence or presence of 5 μM MED, respectively. NFATc1 protein expression was expressed as fold change compared with nonstimulated cells (fold value is 1) and normalized against GAPDH

Fig. 6 Effect of MED on osteoporosis in mice induced by ovariectomy. a Mouse bone mineral density analysis. *p<0.05. b MicroCT images of mouse bones. Mice were subjected to ovariectomy (OVX). After 2 weeks, mice were injected with DMSO, 4 mg/kg/day MED, and 8 mg/kg/day MED every 2 days for 2 months, respectively. At the end points, all mice were sacrificed and both femur and tibia were isolated for bone mineral density analysis and MicroCT analysis

a
Average bone mineral density 0.4

*
0.3 0.2 0.1 0 Sham OVX+DMSO

* *

OVX+MED (4mg/kg/d)

OVX+MED (8mg/kg/d)

b

Sham

OVX+DMSO

OVX+MED (4mg/kg/d)

OVX+MED (8mg/kg/d)

Appl Microbiol Biotechnol

postmenopausal women (Uchida et al. 2011; He et al. 2011b). Since MED can effectively inhibit RANKL-induced osteoclast formation in vitro, we examined whether MED can prevent osteoporosis in ovariectomized mice. As shown in Fig. 6a, MED treatment either at low dose (4 mg/kg/day) or at high dose (8 mg/kg/day) can maintain bone mineral density to near-normal level compared with control group. Consistently, MED treatment prevented mice from trabecular bone loss caused by ovariectomy (Fig. 6b). These results demonstrate that MED can effectively prevent ovariectomyinduced osteoporosis.

Discussion MED, a novel polyketide isolated from the marine fungus D. sp. HLY-1, has various biological effects such as antimicrobial, anti-cancer, and anti-inflammatory activities (Wang et al. 2010), but its effect on osteoclast differentiation has not been studied. In this study, we demonstrated for the first time that MED suppressed osteoclast formation in bone marrow-derived macrophages and bone loss in ovariectomized mice. Using bone marrow-derived macrophages, we found that MED effectively inhibited osteoclast differentiation only when it was added to the medium simultaneously with RANKL, indicating that MED exerts its effect at the very early phase of osteoclast differentiation. In osteoclast differentiation process, there are many signaling pathways involved (Suda et al. 2001; Asagiri and Takayanagi 2007). As RANK was named after its ability to activate NF-κB, inhibition of NF-κB activation might be an effective means to inhibit osteoclastogenesis as well as to cure osteoporosis. In this study, we examined the influence of MED on this signaling pathway. We found that MED could prevent IκBα degradation induced by RANKL stimulation, indicating that MED can inhibit NF-κB activation. In agreement with this notion, we found that MED treatment led to a reduced induction of transcriptional factor NFATc1, which is dominantly regulated by NF-κB (Takatsuna et al. 2005; Asagiri et al. 2005). Consistently, the mRNA levels of osteoclast marker genes such as TRAP, CTR, and cathepsin K were significantly reduced by MED treatment. Besides NF-κB signaling, MAPKs are another important signaling cascade involved in osteoclast differentiation process. It has been reported that inhibition of ERK protein kinase suppresses RANK-induced osteoclastogenesis (Hirata et al. 2010). In addition, ERK is also shown to be involved in osteoclast survival (Miyazaki et al. 2000; Nakamura et al. 2003). Our study showed that MED could effectively prevent RANKL-induced activation of ERK1/2, suggesting that MED inhibits RANKL-induced osteoclastogenesis via the inhibition of ERK activation in addition to the inhibition of NF-κB

activation. Moreover, we found that MED could inhibit RANKL-induced activation of TAK1, an upstream activator of NF-κB and ERK1/2, indicating that MED may target TAK1 or other upstream activators of TAK1 to exert its antiosteoclastogenesis effect. How MED blocks the activation of TAK1 is under investigation. The most significant finding of this study is that MED can effectively prevent ovariectomy-induced osteoporosis in mice. MED treatment can not only maintain bone mineral density but also prevent trabecular bone loss after ovariectomy. Ovariectomy-induced osteoporosis in mice is caused by overactivation of osteoclastogenesis promoted by a dramatic reduction in estrogen level following ovariectomy. This model mimics osteoporosis in postmenopausal woman. Therefore, prevention of ovariectomy-induced osteoporosis in mice by MED may have a potential clinical implication. In summary, we find that MED suppresses osteoclast differentiation by down-regulating NF-κB and ERK1/2 activity via blocking TAK1 activation in vitro and protects mice from bone loss induced by ovariectomy in vivo. These results suggest that MED is a potential lead compound for the development of novel anti-osteoporosis drugs, and marine microbial bioactive compounds may be an important source of new anti-osteoporosis drugs.
Acknowledgments This work was supported by grants from the National Basic Research Program of China (973 Program, 2009CB522200 and 2010CB833802), the Natural Science Foundation of Fujian Province of China (2010 J06014), the Program for New Century Excellent Talents in University of the Ministry of Education (NCET-10-0718), and the Natural Science Foundation of China (30770455 and 31170819). Conflict of interest The authors disclose no conflict of interest.

References
Arai F, Miyamoto T, Ohneda O, Inada T, Sudo T, Brasel K, Miyata T, Anderson DM, Suda T (1999) Commitment and differentiation of osteoclast precursor cells by the sequential expression of c-Fms and receptor activator of nuclear factor kappaB (RANK) receptors. J Exp Med 190:1741–1754 Asagiri M, Takayanagi H (2007) The molecular understanding of osteoclast differentiation. Bone 40:251–264 Asagiri M, Sato K, Usami T, Ochi S, Nishina H, Yoshida H, Morita I, Ef W, Tw M, Serfling E, Takayanagi H (2005) Autoamplification of NFATc1 expression determines its essential role in bone homeostasis. J Exp Med 202:1261–1269 Baron R (2004) Arming the osteoclast. Nat Med 10:458–460 Boyle WJ, Simonet WS, Lacey DL (2003) Osteoclast differentiation and activation. Nature 423:337–342 Chen J, Sun Y, Mao X, Liu Q, Wu H, Chen Y (2010) RANKL up-regulates brain-type creatine kinase via poly(ADP-ribose) polymerase-1 during osteoclastogenesis. J Biol Chem 285:36315–36321 Darnay BG, Ni J, Moore PA, Aggarwal BB (1999) Activation of NFkappaB by RANK requires tumor necrosis factor receptorassociated factor (TRAF) 6 and NF-kappaB-inducing kinase.

Appl Microbiol Biotechnol Identification of a novel TRAF6 interaction motif. J Biol Chem 274:7724–7731 Franzoso G, Carlson L, Xing L, Poljak L, Ew S, Kd B, Leonardi A, Tran T, Bf B, Siebenlist U (1997) Requirement for NF-kappaB in osteoclast and B-cell development. Genes Dev 11:3482–3496 He Y, Staser K, Sd R, Liu Y, Wu X, Sj P, Yuan J, Yang X, Li X, Jiang L, Chen S, Fc Y (2011a) Erk1 positively regulates osteoclast differentiation and bone resorptive activity. PLoS One 6:e24780 He YX, Zhang G, Pan Xh, Liu Z, Lz Z, Cw C, Km L, Yp C, Li G, Wei L, Lk H, Ks L, Qin L (2011b) Impaired bone healing pattern in mice with ovariectomy-induced osteoporosis: a drill-hole defect model. Bone 48:1388–1400 Hirata K, Taki H, Shinoda K, Hounoki H, Miyahara T, Tobe K, Ogawa H, Mori H, Sugiyama E (2010) Inhibition of tumor progression locus 2 protein kinase suppresses receptor activator of nuclear factor-kappaB ligand-induced osteoclastogenesis through downregulation of the c-Fos and nuclear factor of activated T cells c1 genes. Biol Pharm Bull 33:133–137 Hirotani H, Na T, Jt W, Stern Ph, Na C (2004) The calcineurin/nuclear factor of activated T cells signaling pathway regulates osteoclastogenesis in RAW264.7 cells. J Biol Chem 279:13984–13992 Huber DM, Ac B, Pathrose P, Srivastava S, Km D, Nk S, Jw P (2001) Androgens suppress osteoclast formation induced by RANKL and macrophage-colony stimulating factor. Endocrinology 142:3800–3808 Ishida N, Hayashi K, Hoshijima M, Ogawa T, Koga S, Miyatake Y, Kumegawa M, Kimura T, Takeya T (2002) Large scale gene expression analysis of osteoclastogenesis in vitro and elucidation of NFAT2 as a key regulator. J Biol Chem 277:41147–41156 Jiang J, Li H, Fs F, Filbert E, Ke S, Ls S, Zhu Q (2006) Quantitative analysis of osteoclast-specific gene markers stimulated by lipopolysaccharide. J Endod 32:742–746 Kobayashi N, Kadono Y, Naito A, Matsumoto K, Yamamoto T, Tanaka S, Inoue J (2001) Segregation of TRAF6-mediated signaling pathways clarifies its role in osteoclastogenesis. EMBO J 20:1271–1280 Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S, Oliveira-Dos-Santos AJ, Van G, Itie A, Khoo W, Wakeham A, Dunstan CR, Lacey DL, Mak TW, Boyle WJ, Penninger JM (1999) OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397:315–323 Lin X, Huang Y, Fang M, Wang J, Zheng Z, Su W (2005) Cytotoxic and antimicrobial metabolites from marine lignicolous fungi, Diaporthe sp. FEMS Microbiol Lett 251:53–58 Mellis DJ, Itzstein C, Helfrich Mh, Jc C (2011) The skeleton: a multifunctional complex organ: the role of key signalling pathways in osteoclast differentiation and in bone resorption. J Endocrinol 211:131–143 Miyamoto T, Suda T (2003) Differentiation and function of osteoclasts. Keio J Med 52:1–7 Miyazaki T, Katagiri H, Kanegae Y, Takayanagi H, Sawada Y, Yamamoto A, Mp P, Asano T, Im V, Oda H, Nakamura K, Tanaka S (2000) Reciprocal role of ERK and NF-kappaB pathways in survival and activation of osteoclasts. J Cell Biol 148:333–342 Nakamura H, Hirata A, Tsuji T, Yamamoto T (2003) Role of osteoclast extracellular signal-regulated kinase (ERK) in cell survival and maintenance of cell polarity. J Bone Miner Res 18:1198–1205 Nakashima T, Hayashi M, Fukunaga T, Kurata K, Oh-Hora M, Jq F, Lf B, Kodama T, Wutz A, Ef W, Jm P, Takayanagi H (2011) Evidence for osteocyte regulation of bone homeostasis through RANKL expression. Nat Med 17:1231–1234 Omata Y, Tanaka S (2011) RANKL/RANK signaling in rheumatoid arthritis. Clin Calcium 21:1175–1180 Remen KM, Henning P, Lerner Uh, Gustafsson JA, Andersson G (2011) Activation of liver X receptor (LXR) inhibits receptor activator of nuclear factor kappaB ligand (RANKL)-induced osteoclast differentiation in an LXRbeta-dependent mechanism. J Biol Chem 286:33084–33094 Suda T, Kobayashi K, Jimi E, Udagawa N, Takahashi N (2001) The molecular basis of osteoclast differentiation and activation. Novartis Found Symp 232:235–247, discussion 247-250 Takami M, Es C, Sy L, Kamijo R, Yim M (2005) Phosphodiesterase inhibitors stimulate osteoclast formation via TRANCE/RANKL expression in osteoblasts: possible involvement of ERK and p38 MAPK pathways. FEBS Lett 579:832–838 Takao K, Watanabe G, Yasui H, Tadano K (2002) Total synthesis of (+/?)mycoepoxydiene, a novel fungal metabolite having an oxygenbridged cyclooctadiene skeleton. Org Lett 4:2941–2943 Takatsuna H, Asagiri M, Kubota T, Oka K, Osada T, Sugiyama C, Saito H, Aoki K, Ohya K, Takayanagi H, Umezawa K (2005) Inhibition of RANKL-induced osteoclastogenesis by (?)DHMEQ, a novel NF-kappaB inhibitor, through downregulation of NFATc1. J Bone Miner Res 20:653–662 Takayanagi H (2005) Inflammatory bone destruction and osteoimmunology. J Periodontal Res 40:287–293 Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M, Yokochi T, Inoue J, Ef W, Tw M, Kodama T, Taniguchi T (2002) Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev Cell 3:889–901 Teitelbaum SL (2000) Bone resorption by osteoclasts. Science 289:1504– 1508 Uchida R, Chiba H, Ishimi Y, Uehara M, Suzuki K, Kim H, Matsumoto A (2011) Combined effects of soy isoflavone and fish oil on ovariectomy-induced bone loss in mice. J Bone Miner Metab 29:404–413 Wang J, Zhao B, Zhang W, Wu X, Wang R, Huang Y, Chen D, Park K, Bc W, Shen Y (2010) Mycoepoxydiene, a fungal polyketide, induces cell cycle arrest at the G2/M phase and apoptosis in HeLa cells. Bioorg Med Chem Lett 20:7054–7058 Wiktor-Jedrzejczak W, Bartocci A, Aw Ferrante Jr, Ahmed-Ansari A, Sell Kw, Pollard Jw, Stanley Er (1990) Total absence of colonystimulating factor 1 in the macrophage-deficient osteopetrotic (op/ op) mouse. Proc Natl Acad Sci U S A 87:4828–4832 Yamashita M, Otsuka F, Mukai T, Yamanaka R, Otani H, Matsumoto Y, Nakamura E, Takano M, Ke S, Makino H (2010) Simvastatin inhibits osteoclast differentiation induced by bone morphogenetic protein-2 and RANKL through regulating MAPK, AKT and Src signaling. Regul Pept 162:99–108